Online Inquiry
HDAC2 Knockout Cell Line
SPL-01615
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 11bp deletion |
| Target Information | |
|---|---|
| Target Name | HDAC2 |
| Gene Abbr. | HDAC2 |
| Gene ID | 3066 |
| Full Name | histone deacetylase 2 |
| Alias | HD2, KDAC2, RPD3, YAF1 |
| Species | Human |
| Genomic Locus | chr6:113959952 |
| Transcript | NM_001527 |
| WT Expression Level | 181.73 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene product belongs to the histone deacetylase family. Histone deacetylases act via the formation of large multiprotein complexes, and are responsible for the deacetylation of lysine residues at the N-terminal regions of core histones (H2A, H2B, H3 and H4). This protein forms transcriptional repressor complexes by associating with many different proteins, including YY1, a mammalian zinc-finger transcription factor. Thus, it plays an important role in transcriptional regulation, cell cycle progression and developmental events. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of HDAC2. |
| Description | 11bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGGGTCATGCGGATTCTATG |
| PCR Primer |
Forward: GCTACACTGAGTTGTTGCTATACTG Reverse: TGTAATAATGGAGTCTTCAGCTGGT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.