HDAC11 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

HDAC11 cDNA ORF Clone, Human, untagged

HDAC11 cDNA ORF Clone, Human, untagged

SPD-06330

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human histone deacetylase 11.
Target Information
Species Human
Target Name HDAC11
Gene Abbr. HDAC11
Gene ID 79885
Full Name histone deacetylase 11
Alias HD11
Introduction Acetylation of the histone tail causes chromatin to adopt an "open" conformation, allowing increased accessibility of transcription factors to DNA. The identification of histone acetyltransferases (HATs) and their large multiprotein complexes has yielded important insights into how these enzymes regulate transcription. HAT complexes interact with sequence-specific activator proteins to target specific genes. In addition to histones, HATs can acetylate nonhistone proteins, suggesting multiple roles for these enzymes. In contrast, histone deacetylation promotes a "closed" chromatin conformation and typically leads to repression of gene activity. Mammalian histone deacetylases can be divided into three classes on the basis of their similarity to various yeast deacetylases. Class I proteins (HDACs 1, 2, 3, and 8) are related to the yeast Rpd3-like proteins, those in class II (HDACs 4, 5, 6, 7, 9, and 10) are related to yeast Hda1-like proteins, and class III proteins are related to the yeast protein Sir2. Inhibitors of HDAC activity are now being explored as potential therapeutic cancer agents.
Product Details
Description Full length Clone DNA of Human histone deacetylase 11.
NCBI Ref Seq BC009676.1
RefSeq ORF Size 1044 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI (two restriction sites) + XbaI (6.1kb + 0.91kb + 0.13kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.