Online Inquiry
HDAC11 cDNA ORF Clone, Human, N-FLAG tag
SPD-06326
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human histone deacetylase 11 with N terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | HDAC11 |
| Gene Abbr. | HDAC11 |
| Gene ID | 79885 |
| Full Name | histone deacetylase 11 |
| Alias | HD11 |
| Introduction | Acetylation of the histone tail causes chromatin to adopt an "open" conformation, allowing increased accessibility of transcription factors to DNA. The identification of histone acetyltransferases (HATs) and their large multiprotein complexes has yielded important insights into how these enzymes regulate transcription. HAT complexes interact with sequence-specific activator proteins to target specific genes. In addition to histones, HATs can acetylate nonhistone proteins, suggesting multiple roles for these enzymes. In contrast, histone deacetylation promotes a "closed" chromatin conformation and typically leads to repression of gene activity. Mammalian histone deacetylases can be divided into three classes on the basis of their similarity to various yeast deacetylases. Class I proteins (HDACs 1, 2, 3, and 8) are related to the yeast Rpd3-like proteins, those in class II (HDACs 4, 5, 6, 7, 9, and 10) are related to yeast Hda1-like proteins, and class III proteins are related to the yeast protein Sir2. Inhibitors of HDAC activity are now being explored as potential therapeutic cancer agents. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human histone deacetylase 11 with N terminal Flag tag. |
| NCBI Ref Seq | BC009676.1 |
| RefSeq ORF Size | 1044 bp |
| Vector | pCMV3-N-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.