Online Inquiry
HDAC10 Knockout Cell Line
SPL-01611
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 14bp deletion |
| Target Information | |
|---|---|
| Target Name | HDAC10 |
| Gene Abbr. | HDAC10 |
| Gene ID | 83933 |
| Full Name | histone deacetylase 10 |
| Alias | HD10 |
| Species | Human |
| Genomic Locus | chr22:50250883 |
| Transcript | NM_032019 |
| WT Expression Level | 12.89 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene belongs to the histone deacetylase family, members of which deacetylate lysine residues on the N-terminal part of the core histones. Histone deacetylation modulates chromatin structure, and plays an important role in transcriptional regulation, cell cycle progression, and developmental events. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of HDAC10. |
| Description | 14bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GACGCTCGATCTCGCACTCG |
| PCR Primer |
Forward: TAGGCCCAGGTTCTTAGGTTTCTA Reverse: CTTGTGTACCATGAGGACATGACG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.