Online Inquiry
HDAC1 Knockout Cell Line
SPL-01609
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 7bp deletion |
| Target Information | |
|---|---|
| Target Name | HDAC1 |
| Gene Abbr. | HDAC1 |
| Gene ID | 3065 |
| Full Name | histone deacetylase 1 |
| Alias | GON-10, HD1, KDAC1, RPD3, RPD3L1 |
| Species | Human |
| Genomic Locus | chr1:32302668 |
| Transcript | NM_004964 |
| WT Expression Level | 179.01 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Histone acetylation and deacetylation, catalyzed by multisubunit complexes, play a key role in the regulation of eukaryotic gene expression. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family and is a component of the histone deacetylase complex. It also interacts with retinoblastoma tumor-suppressor protein and this complex is a key element in the control of cell proliferation and differentiation. Together with metastasis-associated protein-2, it deacetylates p53 and modulates its effect on cell growth and apoptosis. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of HDAC1. |
| Description | 7bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGAGTCATGCGGATTCGGTG |
| PCR Primer |
Forward: TTCCAGAAGAAAGTGAGCTAGACTG Reverse: AGACTCAAAATGATCCTCCTAGCTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.