HDAC1 Knockout Cell Line - CD BioSciences

service-banner

HDAC1 Knockout Cell Line

HDAC1 Knockout Cell Line

SPL-01608

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name HDAC1
Gene Abbr. HDAC1
Gene ID 3065
Full Name histone deacetylase 1
Alias GON-10, HD1, KDAC1, RPD3, RPD3L1
Species Human
Genomic Locus chr1:32316738
Transcript NM_004964
WT Expression Level 179.01 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Histone acetylation and deacetylation, catalyzed by multisubunit complexes, play a key role in the regulation of eukaryotic gene expression. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family and is a component of the histone deacetylase complex. It also interacts with retinoblastoma tumor-suppressor protein and this complex is a key element in the control of cell proliferation and differentiation. Together with metastasis-associated protein-2, it deacetylates p53 and modulates its effect on cell growth and apoptosis. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of HDAC1.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence CGACATGTTATCTGGACGGA
PCR Primer Forward: TTCTTGAAGCCTGAATCTAACCAGT
Reverse: CTTTAGGAGGTAGGGGAAATCAGG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.