Hdac1 cDNA ORF Clone, Mouse, C-HA tag - CD BioSciences

service-banner

Hdac1 cDNA ORF Clone, Mouse, C-HA tag

Hdac1 cDNA ORF Clone, Mouse, C-HA tag

SPD-06284

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse histone deacetylase 1 with C terminal HA tag.
Target Information
Species Mouse
Target Name HDAC1
Gene Abbr. Hdac1
Gene ID 433759
Full Name histone deacetylase 1
Alias HD1, Hdac1-ps, MommeD, MommeD5, RP
Introduction Acetylation of the histone tail causes chromatin to adopt an "open" conformation, allowing increased accessibility of transcription factors to DNA. The identification of histone acetyltransferases (HATs) and their large multiprotein complexes has yielded important insights into how these enzymes regulate transcription. HAT complexes interact with sequence-specific activator proteins to target specific genes. In addition to histones, HATs can acetylate nonhistone proteins, suggesting multiple roles for these enzymes. In contrast, histone deacetylation promotes a "closed" chromatin conformation and typically leads to repression of gene activity. Mammalian histone deacetylases can be divided into three classes on the basis of their similarity to various yeast deacetylases. Class I proteins (HDACs 1, 2, 3, and 8) are related to the yeast Rpd3-like proteins, those in class II (HDACs 4, 5, 6, 7, 9, and 10) are related to yeast Hda1-like proteins, and class III proteins are related to the yeast protein Sir2. Inhibitors of HDAC activity are now being explored as potential therapeutic cancer agents.
Product Details
Description Full length Clone DNA of Mouse histone deacetylase 1 with C terminal HA tag.
NCBI Ref Seq BC108371
RefSeq ORF Size 1449 bp
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.