HCK Knockout Cell Line - CD BioSciences

service-banner

HCK Knockout Cell Line

HCK Knockout Cell Line

SPL-01604

Size Price
1 Unit Online Inquiry
Description
8bp deletion
Target Information
Target Name Hck
Gene Abbr. HCK
Gene ID 3055
Full Name HCK proto-oncogene, Src family tyrosine kinase
Alias JTK9, p59Hck, p61Hck
Species Human
Genomic Locus chr20:32071737
Transcript NM_002110
WT Expression Level 4.60 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a member of the Src family of tyrosine kinases. This protein is primarily hemopoietic, particularly in cells of the myeloid and B-lymphoid lineages. It may help couple the Fc receptor to the activation of the respiratory burst. In addition, it may play a role in neutrophil migration and in the degranulation of neutrophils. Multiple isoforms with different subcellular distributions are produced due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) codon. [provided by RefSeq, Feb 2010].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of HCK.
Description 8bp deletion
Parental Cell Line C631
Guide RNA Sequence ACACTGTCCTGTGTACGTGC
PCR Primer Forward: TGTAAAACGACGGCCAGACAGCTCTACCTGTTACATTTCTGT
Reverse: CATTGTCACTTCAGCTGCTATCATT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.