Online Inquiry
HAX1 Knockout Cell Line
SPL-01602
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 209bp insertion |
| Target Information | |
|---|---|
| Target Name | HAX1 |
| Gene Abbr. | HAX1 |
| Gene ID | 10456 |
| Full Name | HCLS1 associated protein X-1 |
| Alias | HCLSBP1, HS1BP1, SCN3 |
| Species | Human |
| Genomic Locus | chr1:154273813 |
| Transcript | NM_006118 |
| WT Expression Level | 159.13 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is known to associate with hematopoietic cell-specific Lyn substrate 1, a substrate of Src family tyrosine kinases. It also interacts with the product of the polycystic kidney disease 2 gene, mutations in which are associated with autosomal-dominant polycystic kidney disease, and with the F-actin-binding protein, cortactin. It was earlier thought that this gene product is mainly localized in the mitochondria, however, recent studies indicate it to be localized in the cell body. Mutations in this gene result in autosomal recessive severe congenital neutropenia, also known as Kostmann disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 209bp insertion in a coding exon of HAX1. |
| Description | 209bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TACGGGAGGGACAGACACTT |
| PCR Primer |
Forward: ATAACTTCGGCTTTGATGACCTAGT Reverse: CAAGGCTGGGTCTCAAACAATTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.