HAX1 Knockout Cell Line - CD BioSciences

service-banner

HAX1 Knockout Cell Line

HAX1 Knockout Cell Line

SPL-01602

Size Price
1 Unit Online Inquiry
Description
209bp insertion
Target Information
Target Name HAX1
Gene Abbr. HAX1
Gene ID 10456
Full Name HCLS1 associated protein X-1
Alias HCLSBP1, HS1BP1, SCN3
Species Human
Genomic Locus chr1:154273813
Transcript NM_006118
WT Expression Level 159.13 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is known to associate with hematopoietic cell-specific Lyn substrate 1, a substrate of Src family tyrosine kinases. It also interacts with the product of the polycystic kidney disease 2 gene, mutations in which are associated with autosomal-dominant polycystic kidney disease, and with the F-actin-binding protein, cortactin. It was earlier thought that this gene product is mainly localized in the mitochondria, however, recent studies indicate it to be localized in the cell body. Mutations in this gene result in autosomal recessive severe congenital neutropenia, also known as Kostmann disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 209bp insertion in a coding exon of HAX1.
Description 209bp insertion
Parental Cell Line C631
Guide RNA Sequence TACGGGAGGGACAGACACTT
PCR Primer Forward: ATAACTTCGGCTTTGATGACCTAGT
Reverse: CAAGGCTGGGTCTCAAACAATTT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.