HAT1 Knockout Cell Line - CD BioSciences

service-banner

HAT1 Knockout Cell Line

HAT1 Knockout Cell Line

SPL-01598

Size Price
1 Unit Online Inquiry
Description
11bp deletion
Target Information
Target Name HAT1
Gene Abbr. HAT1
Gene ID 8520
Full Name histone acetyltransferase 1
Alias KAT1
Species Human
Genomic Locus chr2:171946755
Transcript NM_003642
WT Expression Level 82.66 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a type B histone acetyltransferase (HAT) that is involved in the rapid acetylation of newly synthesized cytoplasmic histones, which are in turn imported into the nucleus for de novo deposition onto nascent DNA chains. Histone acetylation, particularly of histone H4, plays an important role in replication-dependent chromatin assembly. Specifically, this HAT can acetylate soluble but not nucleosomal histone H4 at lysines 5 and 12, and to a lesser degree, histone H2A at lysine 5. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jun 2009].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of HAT1.
Description 11bp deletion
Parental Cell Line C631
Guide RNA Sequence AAGAGTTGATGGGTATACTC
PCR Primer Forward: TCATGAAATAGGAATACCTGTCACC
Reverse: ACCATCATTAATACTGCTGTGAGAA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.