HAT1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

HAT1 cDNA ORF Clone, Human, untagged

HAT1 cDNA ORF Clone, Human, untagged

SPD-06270

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human histone acetyltransferase 1.
Target Information
Species Human
Target Name HAT1
Gene Abbr. HAT1
Gene ID 8520
Full Name histone acetyltransferase 1
Alias KAT1
Product Details
Description Full length Clone DNA of Human histone acetyltransferase 1.
NCBI Ref Seq BC063003
RefSeq ORF Size 1005 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.