Online Inquiry
H3-3A Knockout Cell Line
SPL-01595
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp insertion |
| Target Information | |
|---|---|
| Target Name | Histone H3 |
| Gene Abbr. | H3-3A |
| Gene ID | 3020 |
| Full Name | H3.3 histone A |
| Alias | H3-3B, H3.3A, H3F3, H3F3A |
| Species | Human |
| Genomic Locus | chr1:226064378 |
| Transcript | NM_002107 |
| WT Expression Level | 565.72 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene contains introns and its mRNA is polyadenylated, unlike most histone genes. The protein encoded is a replication-independent member of the histone H3 family. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of H3F3A. |
| Description | 2bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTTTACCACCGGTCGATTTG |
| PCR Primer |
Forward: GGTAGACGTAATCTTCACCCTTTCA Reverse: ACATACAAGAGAGACTTTGTCCCAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.