Online Inquiry
GYS1 cDNA ORF Clone, Human, untagged
SPD-06130
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human glycogen synthase 1 (muscle). |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Glycogen Synthase |
| Gene Abbr. | GYS1 |
| Gene ID | 2997 |
| Full Name | glycogen synthase 1 |
| Alias | GSY, GYS |
| Introduction | Glycogen is a polysaccharide of glucose and serves as an energy in mammalian muscle and liver. Glycogen synthase catalyzes the rate-limiting step of glycogen biosynthesis and has two major isoforms in mammals -- muscle isoform (GYS1) and liver isoform (GYS2) respectively. Glycogen synthase kinase-3α (GSK-3α) and glycogen synthase kinase-3β (GSK-3β) phosphorylate glycogen synthase at multiple sites in its C-terminus (Ser641, Ser645, Ser649 and Ser653) inhibiting its activity. Hypoxia alters glycogen metabolism including temporal changes of GYS1 expression and phosphorylation in cancer cells, suggesting the role of metabolic reprogramming of glycogen metabolism in cancer growth. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human glycogen synthase 1 (muscle). |
| NCBI Ref Seq | NM_002103.4 |
| RefSeq ORF Size | 2214 bp |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.