GYS1 cDNA ORF Clone, Human, C-His tag - CD BioSciences

service-banner

GYS1 cDNA ORF Clone, Human, C-His tag

GYS1 cDNA ORF Clone, Human, C-His tag

SPD-06122

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human glycogen synthase 1 (muscle) with C terminal His tag.
Target Information
Species Human
Target Name Glycogen Synthase
Gene Abbr. GYS1
Gene ID 2997
Full Name glycogen synthase 1
Alias GSY, GYS
Introduction Glycogen is a polysaccharide of glucose and serves as an energy in mammalian muscle and liver. Glycogen synthase catalyzes the rate-limiting step of glycogen biosynthesis and has two major isoforms in mammals -- muscle isoform (GYS1) and liver isoform (GYS2) respectively. Glycogen synthase kinase-3α (GSK-3α) and glycogen synthase kinase-3β (GSK-3β) phosphorylate glycogen synthase at multiple sites in its C-terminus (Ser641, Ser645, Ser649 and Ser653) inhibiting its activity. Hypoxia alters glycogen metabolism including temporal changes of GYS1 expression and phosphorylation in cancer cells, suggesting the role of metabolic reprogramming of glycogen metabolism in cancer growth.
Product Details
Description Full length Clone DNA of Human glycogen synthase 1 (muscle) with C terminal His tag.
NCBI Ref Seq NM_002103.4
RefSeq ORF Size 2214 bp
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.