Online Inquiry
GTF2I Knockout Cell Line
SPL-01592
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 28bp deletion |
| Target Information | |
|---|---|
| Target Name | GTF2I |
| Gene Abbr. | GTF2I |
| Gene ID | 2969 |
| Full Name | general transcription factor IIi |
| Alias | BAP135, BTKAP1, DIWS, GTFII-I, IB291 |
| Species | Human |
| Genomic Locus | chr7:74699016 |
| Transcript | NM_001518 |
| WT Expression Level | 170.75 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a phosphoprotein containing six characteristic repeat motifs. The encoded protein binds to the initiator element (Inr) and E-box element in promoters and functions as a regulator of transcription. This locus, along with several other neighboring genes, is deleted in Williams-Beuren syndrome. There are many closely related genes and pseudogenes for this gene on chromosome 7. This gene also has pseudogenes on chromosomes 9, 13, and 21. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Jul 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 28bp deletion in a coding exon of GTF2I. |
| Description | 28bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTACACTCATCCGATTTGCC |
| PCR Primer |
Forward: TTTGCTTTTATAACAAATCACAAATGACT Reverse: TCCTTCAAAATGGAAGTGGAAGAAAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.