Online Inquiry
GSTP1 Knockout Cell Line
SPL-01590
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | GSTP1 |
| Gene Abbr. | GSTP1 |
| Gene ID | 2950 |
| Full Name | glutathione S-transferase pi 1 |
| Alias | DFN7, FAEES3, GST3, GSTP, HEL-S-22 |
| Species | Human |
| Genomic Locus | chr11:67584468 |
| Transcript | NM_000852 |
| WT Expression Level | 3001.09 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Glutathione S-transferases (GSTs) are a family of enzymes that play an important role in detoxification by catalyzing the conjugation of many hydrophobic and electrophilic compounds with reduced glutathione. Based on their biochemical, immunologic, and structural properties, the soluble GSTs are categorized into 4 main classes: alpha, mu, pi, and theta. This GST family member is a polymorphic gene encoding active, functionally different GSTP1 variant proteins that are thought to function in xenobiotic metabolism and play a role in susceptibility to cancer, and other diseases. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of GSTP1. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCATGCGCAGGGCCGCGCAG |
| PCR Primer |
Forward: TGTGAAATCTTCGGAGGAACCTG Reverse: GTATTGGACTGGTACAGGGTGAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.