Gsn cDNA ORF Clone, Mouse, N-His tag - CD BioSciences

service-banner

Gsn cDNA ORF Clone, Mouse, N-His tag

Gsn cDNA ORF Clone, Mouse, N-His tag

SPD-06080

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse gelsolin with N terminal His tag.
Target Information
Species Mouse
Target Name Gelsolin
Gene Abbr. Gsn
Gene ID 227753
Full Name gelsolin
Alias ADF
Introduction Gelsolin (actin-depolymerizing factor, ADF, AGEL, Brevin) is an 83 kDa protein that shares structural and functional homology to villin and adseverin/scinderin. Gelsolin plays an important role in actin filament assembly by capping and severing actin proteins in a Ca2+-dependent manner. Gelsolin is important for cellular events (e.g., membrane ruffling, chemotaxis, ciliogenesis) that require cytoskeletal remodeling. Accordingly, cells from gelsolin knockout mice exhibit motility defects, including a failure to ruffle in response to growth factor stimulation. In humans, defects in gelsolin have been linked to amyloidosis type 5 (AMYL5), a hereditary disease characterized by cranial neuropathy, which appears to result from gelsolin amyloid deposition.
Product Details
Description Full length Clone DNA of Mouse gelsolin with N terminal His tag.
NCBI Ref Seq NM_146120.4
RefSeq ORF Size 2343 bp
Vector pCMV3-SP-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.