Online Inquiry
Gsn cDNA ORF Clone, Mouse, C-Myc tag
SPD-06077
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse gelsolin with C terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | Gelsolin |
| Gene Abbr. | Gsn |
| Gene ID | 227753 |
| Full Name | gelsolin |
| Alias | ADF |
| Introduction | Gelsolin (actin-depolymerizing factor, ADF, AGEL, Brevin) is an 83 kDa protein that shares structural and functional homology to villin and adseverin/scinderin. Gelsolin plays an important role in actin filament assembly by capping and severing actin proteins in a Ca2+-dependent manner. Gelsolin is important for cellular events (e.g., membrane ruffling, chemotaxis, ciliogenesis) that require cytoskeletal remodeling. Accordingly, cells from gelsolin knockout mice exhibit motility defects, including a failure to ruffle in response to growth factor stimulation. In humans, defects in gelsolin have been linked to amyloidosis type 5 (AMYL5), a hereditary disease characterized by cranial neuropathy, which appears to result from gelsolin amyloid deposition. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse gelsolin with C terminal Myc tag. |
| NCBI Ref Seq | NM_146120.4 |
| RefSeq ORF Size | 2343 bp |
| Vector | pCMV3-C-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.