Online Inquiry
GSK3B Knockout Cell Line
SPL-01586
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 31bp deletion |
| Target Information | |
|---|---|
| Target Name | GSK-3 |
| Gene Abbr. | GSK3B |
| Gene ID | 2932 |
| Full Name | glycogen synthase kinase 3 beta |
| Species | Human |
| Genomic Locus | chr3:120093387 |
| Transcript | NM_002093 |
| WT Expression Level | 17.02 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 31bp deletion in a coding exon of GSK3B. |
| Description | 31bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CGGCTTGCAGCTCTCCGCAA |
| PCR Primer |
Forward: TGTAAAACGACGGCCAGTAAAGAGAGAAATCAATGGCAGCCT Reverse: TATCGTTAACCTAACACCCCAACAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.