Online Inquiry
GSK3B cDNA ORF Clone, Human, N-His tag
SPD-06250
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human glycogen synthase kinase 3 beta with N terminal His tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | GSK-3 |
| Gene Abbr. | GSK3B |
| Gene ID | 2932 |
| Full Name | glycogen synthase kinase 3 beta |
| Introduction | Glycogen synthase kinase-3 (GSK-3) was initially identified as an enzyme that regulates glycogen synthesis in response to insulin. GSK-3 is a ubiquitously expressed serine/threonine protein kinase that phosphorylates and inactivates glycogen synthase. GSK-3 is a critical downstream element of the PI3K/Akt cell survival pathway whose activity can be inhibited by Akt-mediated phosphorylation at Ser21 of GSK-3α and Ser9 of GSK-3β. GSK-3 has been implicated in the regulation of cell fate in Dictyostelium and is a component of the Wnt signaling pathway required for Drosophila, Xenopus, and mammalian development. GSK-3 has been shown to regulate cyclin D1 proteolysis and subcellular localization. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human glycogen synthase kinase 3 beta with N terminal His tag. |
| NCBI Ref Seq | NM_001146156.1 |
| RefSeq ORF Size | 1308 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-N-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Restriction Sites | KpnI + XbaI (6kb + 1.31kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.