Online Inquiry
GSK3A Knockout Cell Line
SPL-01585
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp insertion |
| Target Information | |
|---|---|
| Target Name | GSK-3 |
| Gene Abbr. | GSK3A |
| Gene ID | 2931 |
| Full Name | glycogen synthase kinase 3 alpha |
| Species | Human |
| Genomic Locus | chr19:42242307 |
| Transcript | NM_019884 |
| WT Expression Level | 56.85 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a multifunctional Ser/Thr protein kinase that is implicated in the control of several regulatory proteins including glycogen synthase, and transcription factors, such as JUN. It also plays a role in the WNT and PI3K signaling pathways, as well as regulates the production of beta-amyloid peptides associated with Alzheimer's disease. [provided by RefSeq, Oct 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of GSK3A. |
| Description | 2bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GACAGATGCCTTTCCGCCGC |
| PCR Primer |
Forward: TGTAAAACGACGGCCAGGCACATGAAAGAATCTGATGGATGT Reverse: CAGCTAATAGACTGAGTGAGTGGAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.