GSK3A Knockout Cell Line - CD BioSciences

service-banner

GSK3A Knockout Cell Line

GSK3A Knockout Cell Line

SPL-01585

Size Price
1 Unit Online Inquiry
Description
2bp insertion
Target Information
Target Name GSK-3
Gene Abbr. GSK3A
Gene ID 2931
Full Name glycogen synthase kinase 3 alpha
Species Human
Genomic Locus chr19:42242307
Transcript NM_019884
WT Expression Level 56.85 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a multifunctional Ser/Thr protein kinase that is implicated in the control of several regulatory proteins including glycogen synthase, and transcription factors, such as JUN. It also plays a role in the WNT and PI3K signaling pathways, as well as regulates the production of beta-amyloid peptides associated with Alzheimer's disease. [provided by RefSeq, Oct 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of GSK3A.
Description 2bp insertion
Parental Cell Line C631
Guide RNA Sequence GACAGATGCCTTTCCGCCGC
PCR Primer Forward: TGTAAAACGACGGCCAGGCACATGAAAGAATCTGATGGATGT
Reverse: CAGCTAATAGACTGAGTGAGTGGAC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.

We use cookies to understand how you use our site and to improve the overall user experience. This includes personalizing content and advertising. Read our Privacy Policy

Accept Cookies
x