Online Inquiry
GRK5 Knockout Cell Line
SPL-01578
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 10bp deletion |
| Target Information | |
|---|---|
| Target Name | GRK |
| Gene Abbr. | GRK5 |
| Gene ID | 2869 |
| Full Name | G protein-coupled receptor kinase 5 |
| Alias | FP2025, GPRK5 |
| Species | Human |
| Genomic Locus | chr10:119326582 |
| Transcript | NM_005308 |
| WT Expression Level | 5.82 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating their deactivation. It has also been shown to play a role in regulating the motility of polymorphonuclear leukocytes (PMNs). [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of GRK5. |
| Description | 10bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCCAGTGTGAAGACCTCCGA |
| PCR Primer |
Forward: CAGGCATCTTTTTCCCCATCTCTG Reverse: ATACTGTGTCCACTGATTGGCATT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.