Online Inquiry
GRK2 cDNA ORF Clone, Human, C-Myc tag
SPD-06212
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human G protein-coupled receptor kinase 2 |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | GRK |
| Gene Abbr. | GRK2 |
| Gene ID | 156 |
| Full Name | G protein-coupled receptor kinase 2 |
| Alias | ADRBK1, BARK1, BETA-ARK1 |
| Introduction | G-protein-coupled receptor kinase 2 (GRK2), also known as beta-adrenergic receptor kinase 1 (beta-ARK1), is a member of the GRK family, which phosphorylates the activated form of G-protein-coupled receptors (GPCRs) and initiates the desensitization process of GPCR. GRK2 kinase activity and cellular localization are tightly regulated by interactions with activated receptors, G-beta and G-gamma subunits, adaptor proteins, phospholipids, caveolin and calmodulin, as well as by phosphorylation. PKC phosphorylation enhances GRK2 activity by promoting its membrane localization and by abolishing the inhibitory association of calmodulin. PKA phosphorylates GRK2 at Ser685, which facilitates the association of GRK2 with a beta-adrenergic receptor. Erk inhibits GRK2 activity via phosphorylation at Ser670. Src phosphorylates GRK2 at multiple tyrosine residues (Tyr13, 86 and 92), which activates GRK2 activity and promotes GRK2 degradation. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human G protein-coupled receptor kinase 2 |
| NCBI Ref Seq | NM_001619.3 |
| RefSeq ORF Size | 2115 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-Myc |
| Promoter | Enhanced CMV mammalian cell promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Restriction Sites | HindIII + NotI (6kb + 2.12kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.