Online Inquiry
GOLGA2 Knockout Cell Line
SPL-01557
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
13bp deletion |
Target Information | |
---|---|
Target Name | GOLGA2 |
Gene Abbr. | GOLGA2 |
Gene ID | 2801 |
Full Name | golgin A2 |
Alias | GM130 |
Species | Human |
Genomic Locus | chr9:128265643 |
Transcript | NM_004486 |
WT Expression Level | 37.16 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This encoded protein has been postulated to play roles in the stacking of Golgi cisternae and in vesicular transport. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of these variants has not been determined. [provided by RefSeq, Feb 2010]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 13bp deletion in a coding exon of GOLGA2. |
Description | 13bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | CAGTATTCCCGGCGGCGTGT |
PCR Primer |
Forward: CACAAAAGCAGTGATAAATGGCCC Reverse: TCAGAGAAAGCTGAGTTACAGACAG |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.