GNPTG Knockout Cell Line - CD BioSciences

service-banner

GNPTG Knockout Cell Line

GNPTG Knockout Cell Line

SPL-01553

Size Price
1 Unit Online Inquiry
Description
14bp deletion
Target Information
Target Name GNPTG
Gene Abbr. GNPTG
Gene ID 84572
Full Name N-acetylglucosamine-1-phosphate transferase subunit gamma
Alias C16orf27, GNPTAG, LP2537, RJD9
Species Human
Genomic Locus chr16:1352268
Transcript NM_032520
WT Expression Level 13.81 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes the gamma sunbunit of the N-acetylglucosamine-1-phosphotransferase complex. This hexameric complex, composed of alpha, beta and gamma subunits, catalyzes the first step in synthesis of a mannose 6-phosphate lysosomal recognition marker. This enzyme complex is necessary for targeting of lysosomal hydrolases to the lysosome. Mutations in the gene encoding the gamma subunit have been associated with mucolipidosis IIIC, also known as mucolipidosis III gamma.[provided by RefSeq, Feb 2010].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of GNPTG.
Description 14bp deletion
Parental Cell Line C631
Guide RNA Sequence CCTCTTGGCCTGGAGGCGAC
PCR Primer Forward: GAAGATGAAGGTGGTGGAGGAG
Reverse: ATACGTTTTCCAGTTGCATAGACAC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.