Online Inquiry
GNE Knockout Cell Line
SPL-01549
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 40bp deletion |
| Target Information | |
|---|---|
| Target Name | GNE |
| Gene Abbr. | GNE |
| Gene ID | 10020 |
| Full Name | glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase |
| Alias | DMRV, GLCNE, IBM2, NM, Uae1 |
| Species | Human |
| Genomic Locus | chr9:36246417 |
| Transcript | NM_001190388 |
| WT Expression Level | 7.70 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a bifunctional enzyme that initiates and regulates the biosynthesis of N-acetylneuraminic acid (NeuAc), a precursor of sialic acids. It is a rate-limiting enzyme in the sialic acid biosynthetic pathway. Sialic acid modification of cell surface molecules is crucial for their function in many biologic processes, including cell adhesion and signal transduction. Differential sialylation of cell surface molecules is also implicated in the tumorigenicity and metastatic behavior of malignant cells. Mutations in this gene are associated with sialuria, autosomal recessive inclusion body myopathy, and Nonaka myopathy. Alternative splicing of this gene results in transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 40bp deletion in a coding exon of GNE. |
| Description | 40bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGGCTACACACAATTGTGAG |
| PCR Primer |
Forward: TGTCTGATAGAGTCATCAATGGTCC Reverse: TGGTGTTAGATTGCTTTTCTTGCAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.