GNE Knockout Cell Line - CD BioSciences

service-banner

GNE Knockout Cell Line

GNE Knockout Cell Line

SPL-01547

Size Price
1 Unit Online Inquiry
Description
184bp insertion
Target Information
Target Name GNE
Gene Abbr. GNE
Gene ID 10020
Full Name glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Alias DMRV, GLCNE, IBM2, NM, Uae1
Species Human
Genomic Locus chr9:36246417
Transcript NM_001190388
WT Expression Level 7.70 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a bifunctional enzyme that initiates and regulates the biosynthesis of N-acetylneuraminic acid (NeuAc), a precursor of sialic acids. It is a rate-limiting enzyme in the sialic acid biosynthetic pathway. Sialic acid modification of cell surface molecules is crucial for their function in many biologic processes, including cell adhesion and signal transduction. Differential sialylation of cell surface molecules is also implicated in the tumorigenicity and metastatic behavior of malignant cells. Mutations in this gene are associated with sialuria, autosomal recessive inclusion body myopathy, and Nonaka myopathy. Alternative splicing of this gene results in transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 184bp insertion in a coding exon of GNE.
Description 184bp insertion
Parental Cell Line C631
Guide RNA Sequence AGGCTACACACAATTGTGAG
PCR Primer Forward: TGTCTGATAGAGTCATCAATGGTCC
Reverse: TGGTGTTAGATTGCTTTTCTTGCAT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.