Gnaq cDNA ORF Clone, Mouse, N-His tag - CD BioSciences

service-banner

Gnaq cDNA ORF Clone, Mouse, N-His tag

Gnaq cDNA ORF Clone, Mouse, N-His tag

SPD-05908

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse guanine nucleotide binding protein, alpha q polypeptide with N terminal His tag.
Target Information
Species Mouse
Target Name G protein
Gene Abbr. Gnaq
Gene ID 14682
Full Name guanine nucleotide binding protein, alpha q polypeptide
Alias 1110005L02Rik, 6230401I02Rik, AA408290, AW060788, Dsk
Introduction Heterotrimeric guanine nucleotide-binding proteins (G proteins) consist of α, β and γ subunits and mediate the effects of hormones, neurotransmitters, chemokines, and sensory stimuli. To date, over 20 known Gα subunits have been classified into four families, Gα(s), Gα(i/o), Gα(q) and Gα(12), based on structural and functional similarities. Phosphorylation of Tyr356 of Gα(q)/Gα(11) is essential for activation of the G protein, since phenylalanine substitution for Tyr356 changes the interaction of Gα with receptors and abolishes ligand-induced IP3 formation.The Gα(q) guanine nucleotide-binding protein mediates communication between cell surface receptors and the key signal transduction enzyme phospholipase C-β. Mutations in the corresponding GNAQ gene can result in Sturge-Weber syndrome, a neurological and skin disorder characterized by facial port-wine stains, glaucoma, seizures, and mental retardation.
Product Details
Description Full length Clone DNA of Mouse guanine nucleotide binding protein, alpha q polypeptide with N terminal His tag.
NCBI Ref Seq NM_008139.5
RefSeq ORF Size 1080 bp
Vector pCMV3-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.