Online Inquiry
Gnaq cDNA ORF Clone, Mouse, C-His tag
SPD-05904
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse guanine nucleotide binding protein, alpha q polypeptide with C terminal His tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | G protein |
Gene Abbr. | Gnaq |
Gene ID | 14682 |
Full Name | guanine nucleotide binding protein, alpha q polypeptide |
Alias | 1110005L02Rik, 6230401I02Rik, AA408290, AW060788, Dsk |
Introduction | Heterotrimeric guanine nucleotide-binding proteins (G proteins) consist of α, β and γ subunits and mediate the effects of hormones, neurotransmitters, chemokines, and sensory stimuli. To date, over 20 known Gα subunits have been classified into four families, Gα(s), Gα(i/o), Gα(q) and Gα(12), based on structural and functional similarities. Phosphorylation of Tyr356 of Gα(q)/Gα(11) is essential for activation of the G protein, since phenylalanine substitution for Tyr356 changes the interaction of Gα with receptors and abolishes ligand-induced IP3 formation.The Gα(q) guanine nucleotide-binding protein mediates communication between cell surface receptors and the key signal transduction enzyme phospholipase C-β. Mutations in the corresponding GNAQ gene can result in Sturge-Weber syndrome, a neurological and skin disorder characterized by facial port-wine stains, glaucoma, seizures, and mental retardation. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse guanine nucleotide binding protein, alpha q polypeptide with C terminal His tag. |
NCBI Ref Seq | NM_008139.5 |
RefSeq ORF Size | 1080 bp |
Vector | pCMV3-C-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.