GNAQ cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

GNAQ cDNA ORF Clone, Human, untagged

GNAQ cDNA ORF Clone, Human, untagged

SPD-05922

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human guanine nucleotide binding protein (G protein), q polypeptide.
Target Information
Species Human
Target Name G protein
Gene Abbr. GNAQ
Gene ID 2776
Full Name G protein subunit alpha q
Alias CMC1, G-ALPHA-q, GAQ, SWS
Introduction Heterotrimeric guanine nucleotide-binding proteins (G proteins) consist of α, β and γ subunits and mediate the effects of hormones, neurotransmitters, chemokines, and sensory stimuli. To date, over 20 known Gα subunits have been classified into four families, Gα(s), Gα(i/o), Gα(q) and Gα(12), based on structural and functional similarities. Phosphorylation of Tyr356 of Gα(q)/Gα(11) is essential for activation of the G protein, since phenylalanine substitution for Tyr356 changes the interaction of Gα with receptors and abolishes ligand-induced IP3 formation.The Gα(q) guanine nucleotide-binding protein mediates communication between cell surface receptors and the key signal transduction enzyme phospholipase C-β. Mutations in the corresponding GNAQ gene can result in Sturge-Weber syndrome, a neurological and skin disorder characterized by facial port-wine stains, glaucoma, seizures, and mental retardation.
Product Details
Description Full length Clone DNA of Human guanine nucleotide binding protein (G protein), q polypeptide.
NCBI Ref Seq NM_002072.4
RefSeq ORF Size 1080 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.