GNAI1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

GNAI1 cDNA ORF Clone, Human, untagged

GNAI1 cDNA ORF Clone, Human, untagged

SPD-05872

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1.
Target Information
Species Human
Target Name G protein
Gene Abbr. GNAI1
Gene ID 2770
Full Name G protein subunit alpha i1
Alias Gi
Introduction Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling systems.
Product Details
Description Full length Clone DNA of Human guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1.
NCBI Ref Seq NM_002069.5
RefSeq ORF Size 1065 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.