GLRX3 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

GLRX3 cDNA ORF Clone, Human, untagged

GLRX3 cDNA ORF Clone, Human, untagged

SPD-06120

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human protein kinase C, theta.
Target Information
Species Human
Target Name Glutaredoxin
Gene Abbr. GLRX3
Gene ID 10539
Full Name glutaredoxin 3
Alias GLRX4, GRX3, GRX4, PICOT, TXNL2
Introduction This gene encodes a member of the glutaredoxin family. Glutaredoxins are oxidoreductase enzymes that reduce a variety of substrates using glutathione as a cofactor. The encoded protein binds to and modulates the function of protein kinase C theta. The encoded protein may also inhibit apoptosis and play a role in cellular growth, and the expression of this gene may be a marker for cancer. Pseudogenes of this gene are located on the short arm of chromosomes 6 and 9. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq]
Product Details
Description Full length Clone DNA of Human protein kinase C, theta.
NCBI Ref Seq NM_006257.3
RefSeq ORF Size 2121 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 2.12kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.