Online Inquiry
GLRB Knockout Cell Line
SPL-01543
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 13bp deletion |
| Target Information | |
|---|---|
| Target Name | GLRB |
| Gene Abbr. | GLRB |
| Gene ID | 2743 |
| Full Name | glycine receptor beta |
| Alias | HKPX2 |
| Species | Human |
| Genomic Locus | chr4:157120577 |
| Transcript | NM_000824 |
| WT Expression Level | 12.09 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes the beta subunit of the glycine receptor, which is a pentamer composed of alpha and beta subunits. The receptor functions as a neurotransmitter-gated ion channel, which produces hyperpolarization via increased chloride conductance due to the binding of glycine to the receptor. Mutations in this gene cause startle disease, also known as hereditary hyperekplexia or congenital stiff-person syndrome, a disease characterized by muscular rigidity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 13bp deletion in a coding exon of GLRB. |
| Description | 13bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGTTGGCAGGTACTCGGGCA |
| PCR Primer |
Forward: TTGTGGATTTGTCTCAAAAAGGCAG Reverse: TTAGGCATTGAATTGTTCTGAACTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.