Online Inquiry
GIT1 cDNA ORF Clone, Human, untagged
SPD-06086
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human GIT ArfGAP 1. |
Target Information | |
---|---|
Species | Human |
Target Name | GIT-1 |
Gene Abbr. | GIT1 |
Gene ID | 28964 |
Full Name | GIT ArfGAP 1 |
Introduction | G-protein coupled receptor (GPCR) kinase interacting proteins 1 and 2 (GIT-1 and GIT-2) are highly conserved, ubiquitous scaffold proteins involved in localized signaling to help regulate focal contact assembly and cytoskeletal dynamics. GIT proteins contain multiple interaction domains that allow interaction with small GTPases (including ARF, Rac and cdc42), kinases (such as PAK and MEK), the Rho family GEF PIX, and the focal adhesion protein paxillin. GIT-1 is localized to focal adhesions, cytoplasmic complexes and membrane protrusions, and regulates cell protrusion formation and cell migration. GIT-1 has also been implicated in neuronal functions including synapse formation and the pathology of Huntington disease. Huntington disease is a genetic neurodegenerative condition involving a mutation in the huntington gene. The huntington gene product (htt) is ubiquitinated and degraded in human Huntington disease brains. Htt interacts directly with GIT-1 causing enhanced htt proteolysis, indicating that GIT-1 distribution and function may contribute to Huntington disease pathology. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human GIT ArfGAP 1. |
NCBI Ref Seq | NM_001085454.1 |
RefSeq ORF Size | 2313 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-untagged |
Promoter | Enhanced CMV promoter |
Restriction Sites | KpnI + NotI (6kb + 2.31kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Ampicillin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.