Online Inquiry
GGCX Knockout Cell Line
SPL-01516
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 17bp deletion |
| Target Information | |
|---|---|
| Target Name | GGCX |
| Gene Abbr. | GGCX |
| Gene ID | 2677 |
| Full Name | gamma-glutamyl carboxylase |
| Alias | VKCFD1 |
| Species | Human |
| Genomic Locus | chr2:85559004 |
| Transcript | NM_000821 |
| WT Expression Level | 12.76 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes an integral membrane protein of the rough endoplasmic reticulum that carboxylates glutamate residues of vitamin K-dependent proteins to gamma carboxyl glutamate, a modification that is required for their activity. The vitamin K-dependent protein substrates have a propeptide that binds the enzyme, with carbon dioxide, dioxide, and reduced vitamin K acting as co-substrates. Vitamin K-dependent proteins affect a number of physiologic processes including blood coagulation, prevention of vascular calcification, and inflammation. Allelic variants of this gene have been associated with pseudoxanthoma elasticum-like disorder with associated multiple coagulation factor deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 17bp deletion in a coding exon of GGCX. |
| Description | 17bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CCGGAAATACCTTGATGGGC |
| PCR Primer |
Forward: ATTCACCAGCATGCTTCTATTTCTG Reverse: CTGTCAACTGTGTTCCACTGTATTC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.