Online Inquiry
GGA1 Knockout Cell Line
SPL-01513
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
46bp deletion |
Target Information | |
---|---|
Target Name | GGA1 |
Gene Abbr. | GGA1 |
Gene ID | 26088 |
Full Name | golgi associated, gamma adaptin ear containing, ARF binding protein 1 |
Species | Human |
Genomic Locus | chr22:37621649 |
Transcript | NM_013365 |
WT Expression Level | 37.49 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a member of the Golgi-localized, gamma adaptin ear-containing, ARF-binding (GGA) protein family. Members of this family are ubiquitous coat proteins that regulate the trafficking of proteins between the trans-Golgi network and the lysosome. These proteins share an amino-terminal VHS domain which mediates sorting of the mannose 6-phosphate receptors at the trans-Golgi network. They also contain a carboxy-terminal region with homology to the ear domain of gamma-adaptins. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 46bp deletion in a coding exon of GGA1. |
Description | 46bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | TTGGCTGCGCGGAGGTCTTC |
PCR Primer |
Forward: TTCTCACCATTTCACAGAGAGCTTA Reverse: TCTAACTTTTGACGAAGAGGTAGCC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.