GGA1 Knockout Cell Line - CD BioSciences

service-banner

GGA1 Knockout Cell Line

GGA1 Knockout Cell Line

SPL-01510

Size Price
1 Unit Online Inquiry
Description
122bp deletion
Target Information
Target Name GGA1
Gene Abbr. GGA1
Gene ID 26088
Full Name golgi associated, gamma adaptin ear containing, ARF binding protein 1
Species Human
Genomic Locus chr22:37620866
Transcript NM_013365
WT Expression Level 37.49 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the Golgi-localized, gamma adaptin ear-containing, ARF-binding (GGA) protein family. Members of this family are ubiquitous coat proteins that regulate the trafficking of proteins between the trans-Golgi network and the lysosome. These proteins share an amino-terminal VHS domain which mediates sorting of the mannose 6-phosphate receptors at the trans-Golgi network. They also contain a carboxy-terminal region with homology to the ear domain of gamma-adaptins. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 122bp deletion in a coding exon of GGA1.
Description 122bp deletion
Parental Cell Line C631
Guide RNA Sequence ACATTCTTCGGCCGTGGAGG
PCR Primer Forward: AAAAGACTGACCTCCCTCTTCTGTC
Reverse: CTGTATGGGACATACTCAGCACATA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.