GBP5 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

GBP5 cDNA ORF Clone, Human, untagged

GBP5 cDNA ORF Clone, Human, untagged

SPD-06029

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human guanylate binding protein 5.
Target Information
Species Human
Target Name GBP5
Gene Abbr. GBP5
Gene ID 115362
Full Name guanylate binding protein 5
Alias GBP-5
Product Details
Description Full length Clone DNA of Human guanylate binding protein 5.
NCBI Ref Seq BC031639
RefSeq ORF Size 1761 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.