GBP2 cDNA ORF Clone, Human, N-HA tag - CD BioSciences

service-banner

GBP2 cDNA ORF Clone, Human, N-HA tag

GBP2 cDNA ORF Clone, Human, N-HA tag

SPD-06018

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human guanylate binding protein 2, interferon-inducible with N terminal HA tag.
Target Information
Species Human
Target Name GBP2
Gene Abbr. GBP2
Gene ID 2634
Full Name guanylate binding protein 2
Product Details
Description Full length Clone DNA of Human guanylate binding protein 2, interferon-inducible with N terminal HA tag.
NCBI Ref Seq BC073163
RefSeq ORF Size 1818 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Restriction Sites KpnI + NotI (6kb + 1.82kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.