Online Inquiry
GBP1 Knockout Cell Line
SPL-01498
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | GBP1 |
| Gene Abbr. | GBP1 |
| Gene ID | 2633 |
| Full Name | guanylate binding protein 1 |
| Species | Human |
| Genomic Locus | chr1:89063115 |
| Transcript | NM_002053 |
| WT Expression Level | 0.03 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Guanylate binding protein expression is induced by interferon. Guanylate binding proteins are characterized by their ability to specifically bind guanine nucleotides (GMP, GDP, and GTP) and are distinguished from the GTP-binding proteins by the presence of 2 binding motifs rather than 3. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of GBP1. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CACCACCATAGGCTGTGTAA |
| PCR Primer |
Forward: TTGATTCTTATCCCCTAGAACAGCG Reverse: GAGTGTTGATAAGTCACTGTCATGC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.