GAK Knockout Cell Line - CD BioSciences

service-banner

GAK Knockout Cell Line

GAK Knockout Cell Line

SPL-01461

Size Price
1 Unit Online Inquiry
Description
14bp deletion
Target Information
Target Name GAK
Gene Abbr. GAK
Gene ID 2580
Full Name cyclin G associated kinase
Alias DNAJ26, DNAJC26
Species Human
Genomic Locus chr4:904723
Transcript NM_005255
WT Expression Level 24.08 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction In all eukaryotes, the cell cycle is governed by cyclin-dependent protein kinases (CDKs), whose activities are regulated by cyclins and CDK inhibitors in a diverse array of mechanisms that involve the control of phosphorylation and dephosphorylation of Ser, Thr or Tyr residues. Cyclins are molecules that possess a consensus domain called the 'cyclin box.' In mammalian cells, 9 cyclin species have been identified, and they are referred to as cyclins A through I. Cyclin G is a direct transcriptional target of the p53 tumor suppressor gene product and thus functions downstream of p53. GAK is an association partner of cyclin G and CDK5. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of GAK.
Description 14bp deletion
Parental Cell Line C631
Guide RNA Sequence AGGCCCCCTTTCGTGCGACA
PCR Primer Forward: TGTAAAACGACGGCCAGCATCTTCTAGGTGAGATGGTGTAGC
Reverse: GAGTTTCATTCTCTTTTAGGGCAGC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.