Gadd45g cDNA ORF Clone, Mouse, N-Myc tag - CD BioSciences

service-banner

Gadd45g cDNA ORF Clone, Mouse, N-Myc tag

Gadd45g cDNA ORF Clone, Mouse, N-Myc tag

SPD-05980

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse growth arrest and DNA-damage-inducible 45 gamma with N terminal Myc tag.
Target Information
Species Mouse
Target Name GADD45γ
Gene Abbr. Gadd45g
Gene ID 23882
Full Name growth arrest and DNA-damage-inducible 45 gamma
Alias AI327420, C86281, CR, CR6, DDIT2
Introduction This gene is a member of a group of genes whose transcript levels are increased following stressful growth arrest conditions and treatment with DNA-damaging agents. The protein encoded by this gene responds to environmental stresses by mediating activation of the p38/JNK pathway via MTK1/MEKK4 kinase. The GADD45G is highly expressed in placenta.
Product Details
Description Full length Clone DNA of Mouse growth arrest and DNA-damage-inducible 45 gamma with N terminal Myc tag.
NCBI Ref Seq NM_011817.2
RefSeq ORF Size 525 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-N-Myc
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6kb + 0.53kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.