Online Inquiry
Gadd45g cDNA ORF Clone, Mouse, N-HA tag
SPD-05981
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse growth arrest and DNA-damage-inducible 45 gamma with N terminal HA tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | GADD45γ |
Gene Abbr. | Gadd45g |
Gene ID | 23882 |
Full Name | growth arrest and DNA-damage-inducible 45 gamma |
Alias | AI327420, C86281, CR, CR6, DDIT2 |
Introduction | This gene is a member of a group of genes whose transcript levels are increased following stressful growth arrest conditions and treatment with DNA-damaging agents. The protein encoded by this gene responds to environmental stresses by mediating activation of the p38/JNK pathway via MTK1/MEKK4 kinase. The GADD45G is highly expressed in placenta. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse growth arrest and DNA-damage-inducible 45 gamma with N terminal HA tag. |
NCBI Ref Seq | NM_011817.2 |
RefSeq ORF Size | 480 bp |
Vector | pCMV3-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.