Gadd45a cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Gadd45a cDNA ORF Clone, Mouse, untagged

Gadd45a cDNA ORF Clone, Mouse, untagged

SPD-05953

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse growth arrest and DNA-damage-inducible 45 alpha.
Target Information
Species Mouse
Target Name GADD45α
Gene Abbr. Gadd45a
Gene ID 13197
Full Name growth arrest and DNA-damage-inducible 45 alpha
Alias AA545191, Ddit, Ddit1, GADD45
Introduction GADD45 α, β and γ are an evolutionarily conserved, homologous family of nuclear proteins that function as stress sensors for cellular physiological and environmental damage. GADD45 proteins are required for the activation of the G2/M checkpoint induced by UV radiation or alkylating agents. GADD45-induced G2/M checkpoint is regulated through inactivation of Cdc2-cyclin B1 kinase. GADD45 forms a complex with p21 and Cdc2, and may serve as core for interaction with other cell cycle regulators.
Product Details
Description Full length Clone DNA of Mouse growth arrest and DNA-damage-inducible 45 alpha.
NCBI Ref Seq NM_007836.1
RefSeq ORF Size 498 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.