Online Inquiry
GADD45A cDNA ORF Clone, Human, C-His tag
SPD-05955
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human growth arrest and DNA.-damage-inducible, alpha with C terminal His tag. |
Target Information | |
---|---|
Species | Human |
Target Name | GADD45α |
Gene Abbr. | GADD45A |
Gene ID | 1647 |
Full Name | growth arrest and DNA damage inducible alpha |
Alias | DDIT1, GADD45 |
Introduction | GADD45 α, β and γ are an evolutionarily conserved, homologous family of nuclear proteins that function as stress sensors for cellular physiological and environmental damage. GADD45 proteins are required for the activation of the G2/M checkpoint induced by UV radiation or alkylating agents. GADD45-induced G2/M checkpoint is regulated through inactivation of Cdc2-cyclin B1 kinase. GADD45 forms a complex with p21 and Cdc2, and may serve as core for interaction with other cell cycle regulators. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human growth arrest and DNA.-damage-inducible, alpha with C terminal His tag. |
NCBI Ref Seq | NM_001924.2 |
RefSeq ORF Size | 498 bp |
Vector | pCMV3-C-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.