GADD45A cDNA ORF Clone, Human, C-His tag - CD BioSciences

service-banner

GADD45A cDNA ORF Clone, Human, C-His tag

GADD45A cDNA ORF Clone, Human, C-His tag

SPD-05955

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human growth arrest and DNA.-damage-inducible, alpha with C terminal His tag.
Target Information
Species Human
Target Name GADD45α
Gene Abbr. GADD45A
Gene ID 1647
Full Name growth arrest and DNA damage inducible alpha
Alias DDIT1, GADD45
Introduction GADD45 α, β and γ are an evolutionarily conserved, homologous family of nuclear proteins that function as stress sensors for cellular physiological and environmental damage. GADD45 proteins are required for the activation of the G2/M checkpoint induced by UV radiation or alkylating agents. GADD45-induced G2/M checkpoint is regulated through inactivation of Cdc2-cyclin B1 kinase. GADD45 forms a complex with p21 and Cdc2, and may serve as core for interaction with other cell cycle regulators.
Product Details
Description Full length Clone DNA of Human growth arrest and DNA.-damage-inducible, alpha with C terminal His tag.
NCBI Ref Seq NM_001924.2
RefSeq ORF Size 498 bp
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.