Online Inquiry
GABRB3 Knockout Cell Line
SPL-01455
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | GABRB3 |
| Gene Abbr. | GABRB3 |
| Gene ID | 2562 |
| Full Name | gamma-aminobutyric acid type A receptor subunit beta3 |
| Alias | DEE43, ECA5, EIEE43 |
| Species | Human |
| Genomic Locus | chr15:26621438 |
| Transcript | NM_001191321 |
| WT Expression Level | 19.43 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the ligand-gated ionic channel family. The encoded protein is one the subunits of a multi-subunit chloride channel that serves as the receptor for gamma-aminobutyric acid, a major inhibitory neurotransmitter of the mammalian nervous system. This gene is located on the long arm of chromosome 15 in a cluster with two other genes encoding related subunits of the family. This gene may be associated with the pathogenesis of several disorders including Angelman syndrome, Prader-Willi syndrome, nonsyndromic orofacial clefts, epilepsy and autism. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of GABRB3. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CCACTCGATTGTCAAGCGTG |
| PCR Primer |
Forward: GCTTTAGTGCTTCATAGATGCTTCC Reverse: TGGCTGGGTACAAACTAACTTTCTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.