Online Inquiry
GABRA5 Knockout Cell Line
SPL-01452
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
22bp deletion |
Target Information | |
---|---|
Target Name | GABRA5 |
Gene Abbr. | GABRA5 |
Gene ID | 2558 |
Full Name | gamma-aminobutyric acid type A receptor subunit alpha5 |
Alias | DEE79, EIEE79 |
Species | Human |
Genomic Locus | chr15:26880937 |
Transcript | NM_000810 |
WT Expression Level | 25.13 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. Transcript variants utilizing three different alternative non-coding first exons have been described. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 22bp deletion in a coding exon of GABRA5. |
Description | 22bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | TACGACAACAGACTTCGGCC |
PCR Primer |
Forward: TCCCTGGTTTCTGTATCTTGAGAAG Reverse: TTAGGAATTGTTTGAATCAGCGCAA |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.