Online Inquiry
GABBR1 Knockout Cell Line
SPL-01451
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
89bp insertion |
Target Information | |
---|---|
Target Name | GABA-B R1 |
Gene Abbr. | GABBR1 |
Gene ID | 2550 |
Full Name | gamma-aminobutyric acid type B receptor subunit 1 |
Alias | GABABR1, GABBR1-3, GB1, GPRC3A |
Species | Human |
Genomic Locus | chr6:29627626 |
Transcript | NM_001470 |
WT Expression Level | 9.95 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a receptor for gamma-aminobutyric acid (GABA), which is the main inhibitory neurotransmitter in the mammalian central nervous system. This receptor functions as a heterodimer with GABA(B) receptor 2. Defects in this gene may underlie brain disorders such as schizophrenia and epilepsy. Alternative splicing generates multiple transcript variants, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jan 2016]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 89bp insertion in a coding exon of GABBR1. |
Description | 89bp insertion |
Parental Cell Line | C631 |
Guide RNA Sequence | ACGGCGCGCAGTGTACATCG |
PCR Primer |
Forward: AATCCCAGAGACGACTCAGACAGAT Reverse: CTGCCGCTTCTGGTTGTGAT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.