GAB2 cDNA ORF Clone, Human, N-HA tag - CD BioSciences

service-banner

GAB2 cDNA ORF Clone, Human, N-HA tag

GAB2 cDNA ORF Clone, Human, N-HA tag

SPD-05941

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human GRB2-associated binding protein 2 with N terminal HA tag.
Target Information
Species Human
Target Name GAB2
Gene Abbr. GAB2
Gene ID 9846
Full Name GRB2 associated binding protein 2
Introduction The Grb-associated binder (Gab) family is a family of adaptor proteins recruited by a wide variety of receptor tyrosine kinases (RTKs) such as EGFR, HGFR, insulin receptor, cytokine receptor and B cell antigen receptors. Upon stimulation of RTKs by their cognate ligand, Gab is recruited to the plasma membrane where it is phosphorylated and functions as a scaffold. Multiple tyrosine phosphorylation sites of Gab1 protein have been identified. Phosphorylation of Tyr472 regulates its binding to p85 PI3 kinase. Phosphorylation of Gab1 at Tyr307, Tyr373 and Tyr407 modulates its association to PLCγ. Phosphorylation of Tyr627 and Tyr659 is required for Gab1 binding to and activation of the protein tyrosine phosphatase SHP2.Gab2 is also phosphorylated by tyrosine kinases. Tyr452 is a potential binding site of p85, the regulatory subunit of PI3 kinase. Tyr614 is essential for SHP2 association. Furthermore, Akt phosphorylates Gab2 at Ser159 and inhibits Gab2 tyrosine phosphorylation, suggesting that Akt is engaged in negative feedback regulation of Gab2 signaling.
Product Details
Description Full length Clone DNA of Human GRB2-associated binding protein 2 with N terminal HA tag.
NCBI Ref Seq BC131711
RefSeq ORF Size 2031 bp
Vector pCMV3-SP-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.