GAB1 cDNA ORF Clone, Human, N-His tag - CD BioSciences

service-banner

GAB1 cDNA ORF Clone, Human, N-His tag

GAB1 cDNA ORF Clone, Human, N-His tag

SPD-05929

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human GRB2-associated binding protein 1 with N terminal His tag.
Target Information
Species Human
Target Name GAB1
Gene Abbr. GAB1
Gene ID 2549
Full Name GRB2 associated binding protein 1
Alias DFNB26
Introduction The Grb-associated binder (Gab) family is a family of adaptor proteins recruited by a wide variety of receptor tyrosine kinases (RTKs) such as EGFR, HGFR, insulin receptor, cytokine receptor and B cell antigen receptors. Upon stimulation of RTKs by their cognate ligand, Gab is recruited to the plasma membrane where it is phosphorylated and functions as a scaffold. Multiple tyrosine phosphorylation sites of Gab1 protein have been identified. Phosphorylation of Tyr472 regulates its binding to p85 PI3 kinase. Phosphorylation of Gab1 at Tyr307, Tyr373 and Tyr407 modulates its association to PLCγ. Phosphorylation of Tyr627 and Tyr659 is required for Gab1 binding to and activation of the protein tyrosine phosphatase SHP2.
Product Details
Description Full length Clone DNA of Human GRB2-associated binding protein 1 with N terminal His tag.
NCBI Ref Seq BC064848
RefSeq ORF Size 2175 bp
Vector pCMV3-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.